The Tree/Web of Life (Lesson 20: The twisted ladder)

LESSON PLAN: MIDDLE SCHOOL
DNA, the twisted ladder.
[ezcol_1quarter]Main Idea:[/ezcol_1quarter] [ezcol_3quarter_end] The DNA structure resembles a ladder, with the rungs representing the bases and the two sides of the ladder representing the sugar phosphate backbone. DNA replicates by using its property of binding complementary bases; adenine binds thymine (AT) and guanine binds cytosine (GC).[/ezcol_3quarter_end]

[ezcol_1quarter]Objectives:[/ezcol_1quarter] [ezcol_3quarter_end] 1. To explore DNA structure by constructing a DNA model out of paper.
2. To verbalize the importance of understanding how the message in the DNA is always preserved: Replication.
3. To be able to describe how errors in copying DNA cause differences in the message or instructions.
[/ezcol_3quarter_end]

[ezcol_1quarter]Students’ Skills:[/ezcol_1quarter] [ezcol_3quarter_end] Observation, application, analysis, making use of knowledge, synthesis. These skills were drawn from Bloom’s Taxonomy and the constructivist list. NGSS connections: MS-LS1 From Molecules to Organisms: Structures and Processes, MS-LS3 Heredity: Inheritance and Variation of Traits, and MS-LS4 Biological Evolution: Unity and Diversity..[/ezcol_3quarter_end]

[ezcol_1quarter]Materials[/ezcol_1quarter] [ezcol_3quarter_end] 1. For the lecture and discussion: textbooks, material reference.
2. For the activity: long strips of paper, many paper squares in four different colors, tape, crayons, pens. [/ezcol_3quarter_end]

[ezcol_1quarter]Lesson:[/ezcol_1quarter] [ezcol_3quarter_end]1. Entry card: Remember the characteristics of the strawberry DNA that you extracted, and recall that DNA is the recipe to make organisms. With these ideas in mind, what shape do you think DNA is? Allow time for the students to think and to write down their responses. Discuss the importance of learning about DNA structure and function, and how this lesson relates to past lessons. Write the objectives on the board.

2. Make a line on the board and remind students of past classes, when we were building organisms. Ask them to recall that DNA gives the instructions, the recipe, to make an organism. Use the book analogy and tell students that DNA does not use 23 characters (A-Z) like we do in English, but only four, ATGC, and that they are called nucleotides. Scientists usually translate DNA language into English, to find out what the genes mean. Answer student questions.

3. Divide the class into groups of four students (pair 1 and pair 2) to “make your DNA ladder.” Give each six long strips of paper of the same color (for example, blue) representing the DNA backbone, and two long strips of a slightly different shade of color (dark blue). Also give them enough paper nucleotides in four different colors, assign a color to each nucleotide, and write it on the board with big, clear letters. Students also need tape, crayons, and ONE written sequence of 10 nucleotides per pair of students. Keep a record of what group got what sequence.

4. Tell the students to work in pairs and to tape the paper nucleotides to the backbone of the dark blue strip, following the given sequence. It is important to give them time limits, and to allot the same time for every copy (replication). Once time is up, collect the nucleotide sequence. Then, pair 1 students should swap their one-strand DNA with pair 2 students.

5. In order to make a complete DNA molecule, ask students to construct the complementary strands by using the rule “A pairs with T and C pairs with G” (write the rule on the board). Point out that the nucleotides have different colors. Use time limits.

6. Ask students to separate the two strands, so that each student has one strand. Have each student complete another DNA molecule. Use time limits. Point out they have now a duplicate piece of DNA, and that normally cells replicate their DNA before division.

7. Have the students tape the two strands of their DNA in the middle to form a complete ladder. Then, they should twist one end of the ladder 180 degrees to get a feeling of the 3D structure of DNA. Discuss their ideas about replication.

8. Ask students to write the sequence of their DNA on their handouts, and to compare it to the initial sequence that you gave them. The sequences should be written on the board as double-stranded DNA. Are there any errors?

9. Exit card: Briefly, write how DNA duplicates/replicates and why we are using two different colors for the DNA backbone.

[/ezcol_3quarter_end]

[ezcol_1quarter]Class Closing:[/ezcol_1quarter] [ezcol_3quarter_end]
1. Collect entry/exit cards.

2. Each student is responsible for cleaning up her or his area.

3. Homework: Using DNA language, write the complimentary strands for these pieces of DNA. Remember the rule: A binds T and C binds G.
(a) ATGCAGCTGACACTGATCAT,
(b) GCGCTAGCAATTATCGTTT,
(c) TACACACAGTGTCACAGATA.
[/ezcol_3quarter_end]

[ezcol_1quarter]Assesment:[/ezcol_1quarter] [ezcol_3quarter_end] 1. Participation in class and discussions. Presentation of results, thoroughness and detail in completing their work.
2. Grading: Homework.
3. Use a general rubric to evaluate the students’ overall performance.[/ezcol_3quarter_end]

[ezcol_1quarter]Teacher’s Reflections[/ezcol_1quarter] [ezcol_3quarter_end]1. Things that I did not cover.
2. Did I meet the lesson objectives?
3. Comments, conclusions, and modifications.
4. Pedagogical value of the lesson. Did my students learn the concepts and ideas explored in this class? Did the assessments provide enough evidence of understanding?[/ezcol_3quarter_end]

[ezcol_1quarter]Notes to the Teacher[/ezcol_1quarter] [ezcol_3quarter_end]1.This class connects the DNA lab, where the students saw the DNA fibers, to the long shape of DNA strands, and the idea that a long sequence of letters can contain sentences (genes) embedded in it. It is an enjoyable class for students because they construct a model.

2. Another idea that follows from the point above is that the structure of DNA is perfectly suited to its function. If you lose one strand, the information is not lost, because you can read it from the other strand.

3. It is important to have a time limit when students are copying DNA because someone may make a mistake and end up with a slightly different DNA molecule. This gives an illustration of how differences arise between cells and organisms.

4. Some students may easily grasp these concepts. However, they may be difficult for other students. The teacher needs to pay close attention, and give support or challenges as required.

[/ezcol_3quarter_end]

 

ACTIVITY: MIDDLE SCHOOL
DNA, the twisted ladder, has an ideal structure-function relationship. This is crucial in order to preserve the message of how to make organisms, through billions of years.

cropped-owlet_logo.gifThe DNA structure resembles a ladder, with the rungs representing the nucleotides and the two sides of the ladder representing the backbone. DNA replicates by opening up the ladder in the middle, and adding a complimentary half-ladder by using its property of binding complementary bases; adenine binds thymine (AT) and guanine binds cytosine (GC). Let us find out exactly how this happens.

 

Before you start your activity, read the instructions completely. Some steps in the activity will be timed, and you do not want to lose time by stopping and reading the instructions again. Your teacher will guide you.

1. Your teacher will place you in a group of four (two pairs) students. You will receive eight long blue strips of paper representing the DNA backbone (two of which are of a slightly different tone, dark blue), enough paper nucleotides of different colors, tape, crayons, and ONE written sequence of 10 nucleotides per pair of students.

2. Working in pairs, tape the paper nucleotides to the dark blue backbone following the given sequence. Wait until your teacher gives the “GO” to start working, and stop when told. Once finished, pair 1 students should swap their one-strand DNA with pair 2 students. Do not share the initial sequence.

3. To make a complete DNA molecule (double stranded), construct the complementary strand by using as a backbone a light-blue long strip. The rungs are made by using these rules: nucleotide A pairs with nucleotide T (A pairs with T), and C pairs with G.

4. Then, separate the two strands, so that each student has one strand. Working on your own, complete another DNA molecule by the same procedure. Again. wait for the “GO” to start working. When finished making the DNA double strand, tape the two strands in the middle so your ladder is completed.

5. Once you have taped the two strands of DNA together in the middle, twist one end 180 degrees, to get the 3D structure of DNA.

6. Write the sequence of your DNA ladder below, and compare it to the initial sequence that your teacher gave you. Are there any errors?

 

 

 

7. If there are no errors, then the message is exactly the same, and there is no change. The two pieces of DNA are similar. But what if there are errors? What are the consequences for the fidelity or correctness of the message?

 

 

 

8. Pretend that the sequence given to you, if translated into English, says: “Make the skin purple, but with no orange dots.” But if there are errors, what could happen?

 

 

 

9. The structure of DNA is perfectly suited to its function. If you lose one strand (half the ladder), can you still retrieve the information? How?

 

 

 

 

10. Bonus points: Do you think this is how animals became different? Yes or no? Why?